Skip to main content

Table 4 Primer sequences used and amplicon sizes of Nup107 and tin for RFLP

From: Efficient In Vivo Introduction of Point Mutations Using ssODN and a Co-CRISPR Approach

  Nup107 tin
Forward primer GAGCAGAATGTCTCGGTGCT ATTCCGATGCTGTGCTGTGATTG
Reverse primer AGGAAGAGCACTATGTGGGC TTAAATAAGTCCAACAATTTGCC
PCR product length (bp) 512 498
Digestion enzyme (recognition site) ApaI (GGGCC^C) NlaIII (CATG^)
Digested product size (bp, WT/mutant) 311 + 201/512 412 + 86 / 348 + 86 + 64