Skip to main content

Table 2 Sequences for ssODN design. PAM is underlined, gRNA DSB site is indicated by a slash (/), and the introduced mutations locations are indicated in BOLD

From: Efficient In Vivo Introduction of Point Mutations Using ssODN and a Co-CRISPR Approach

  Nup107 tin
Locus Chr2L (-) Chr3R (+)
Genomic sequence GCCGATTCCAAGAACTATGACGAGTACAGCCGCGCGACGGCGGGTGTCTTCTCCGGCCACTTGGGCTCGCTGAAAACCCTTTTGCACAGCAACTGGCACGATTTGCTCTGGGCCCATC/TGAAGGTGCAGATCGACATCCGTGTGGAATCGGAGATACGCGGCTGCTGCCTCAAAAACTACCAACCGATGCCCGATGATT TGAGGCGGTCTGGGGTGAAAGGAGTACGCGTTCAGTACCAAAATCGAGCTGACAAATTGCAG/ACACGGTCGAGTGCGCATCGGAACGGCGCTTTACGGCTTACGGGTTACGGACTACTGATTGCCGATTACGGGC
gRNA target TTTGCTCTGGGCCCATCTGAAGG GAGCTGACAAATTGCAGACACGG
Designed ssODN GCCGATTCCAAGAACTATGACGAGTACAGCCGCGCGACGGCGGGTGTCTTCTCCGGCCACTTGGGCTCGCTGAAAACCCTTTTGCACAGCAACTGGCACaATTTGCTCTGGGCtCAcCTGAAGGTGCAGATCGACATCCGTGTGGAATCGGAGATACGCGGCTGCTGCCTCAAAAACTACCAACCGATGCCCGATGATT TGAGGCGGTCTGGGGTGAAAGGAGTACGCGTTCAGTACCAAAATCGAGCTGACAAATTGCctcatgtGTCGAGTGCGCATCGGAACGGCGCTTTACGGCTTACGGGTTACGGACTACTGATTGCCG