Table 2 The list of candidate TDFs and their gene specific primer sequences that were used for RT-qPCR. Prediction of subcellular localization was done base on their gene homologues in Setaria italica
Gene symbol | Name | Function | Gene homologues in Setaria italica | Predicted subcellular location | Primer sequence | Amp. size |
|---|---|---|---|---|---|---|
SYP81 | Syntaxin of plants 81 | Vesicle trafficking protein that functions in the secretory pathway. | XP_004976323 | Nucleus | CAGCATGGCGTGGCTCTTAT AGCATCTTGAAAGCGCATGG | 90 |
CAND1 | Cullin-associated and neddylation-dissociated | Key assembly factor of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complexes that promotes the exchange of the substrate-recognition F-box subunit in SCF complexes | AT2G02560 cell-to-cell mobile RNA XP_004951789.1 | Chloroplast | TGGCAGTGACTACAGCATACGG ACTGCGCACAGAGCGGTACT | 91 |
SAMDC | S-adenosylmethionine decarboxylase | Essential for polyamine homeostasis, and normal plant embryogenesis, growth and development. | XP_004953064.1 | Cytoplasm | CCATCCATGGTCCTGCTTTC GGGTTGAAGCCCATGACCTC | 81 |
Katanin | Katanin p80 WD40 | Microtubule severing | XP_012700331.1 | Chloroplast | TGATCCCTCCCTTCCCAGTT CCTGAGCGAATGCGTAAACC | 98 |
ISB1 | Importin subunit beta-1 | Protein transporter activity | XP_004962709.1 | Cytoplasm | GCTCCAGCCAAATGTCAAGC GGTCTTGGTCAACAGCTTCAGG | 86 |
GlyI | Glyoxalase I | Carbohydrate metabolic process | XP_004952236.1 | Chloroplast | GTGGCATGGACTTGCTACGG CCGTGGCATCACAGAGGATT | 92 |
HAK18 | High-affinity potassium transporter | Potassium ion transmembrane transporter activity | XP_004956156.1 | Plasma membrane | GGCCAGACATTTCAGACCACA AGCCCTGATGACCGTGTTTC | 99 |
ZF30 | Zinc finger CCCH domain-containing protein 24 | Regulation of transcription | XP_004982091.1 | Nucleus | GCTCTTGTTGGCTCCCCTCT TCACCATTTACGCCCCAATC | 83 |
RPS3 | 40S ribosomal protein S3-like | Structural constituent of ribosome involved in RNA methylation, photorespiration, translation | XP_004972758.1 | Chloroplast | ATTCACTGGCTGACCGGATG GTGCCAAGGGTTGTGAGGTC | 107 |
UBQ | Ubiquitin-like protein | Biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites | XP_004957594.1 | Chloroplast | CTTGGTCTGCTGTTGTCTTG CACGGTTCACTTATCCATCAC | 200 |
EF1A | Elongation factor-1 alpha | Translation elongation factor activity | XP_004984833.1 | Cytoplasm | TGCTGTCGGTGTCATCAA CTTCCATCAAACGCCTCATT | 97 |
U2SURP | U2snRNP-associated SURP motif-containing protein-like | RNA binding, required for spliceosome assembly to participate in splicing | XP_004951689.1 | Nucleus | CGTGGATGAGATTGAGAGGAA TGGAGGACTACGGCTTCTA | 199 |
GTF | General transcription factor 3C polypeptide | Involved in RNA polymerase III-mediated transcription | XP_004975210.1 | Nucleus | TTCCAAGTGGCCATCAGGTT AAAGGGCTTCCTGCCTCTTG | 108 |