Skip to main content

Table 1 Primers Used for Mutagenesis

From: Enhanced Mutant Screening in One-step PCR-based Multiple Site-directed Plasmid Mutagenesis by Introduction of Silent Restriction Sites for Structural and Functional Study of Proteins

HP-NAP mutants Primer sequence (5′-3′)a, b, c Tmpp (°C)d, e Tmno (°C)d, f, g Inserted silent restriction sites Size of the digested products (bp)h
HP-NAPD98A F: AAATT CTcGAG GctTACAAA TATCTAGAAAAAGAATTTAAAGAGC 54 62 XhoI 5261, 307
  R: TTTGTAagC CTCgAG AATTT CTTTAAAGATGTCTTTAGAGTGG 54 62   
HP-NAPY99A F: ATT CTcGAG GACgcCAAA TATCTAGAAAAAGAATTTAAAGAGC 54 62 XhoI 5261, 307
  R: TTTGgcGTC CTCgAG AAT TTCTTTAAAGATGTCTTTAGAGTGG 54 66   
HP-NAPY101H F: ACAAAcAT CTcGAg AAAGAA TTTAAAGAGCTCTCTAACACC 54 58 XhoI 5261, 307
  R: TTCTTT cTCgAG ATgTTTGT AGTCCTCTAGAATTTCTTTAAAGA 54 62   
HP-NAPE103A F: TCTAGcAAAA GAATTc AAAGA GCTCTCTAACACCGCTGAAAA 54 62 EcoRI 5568
  R: TCTTT gAATTC TTTTgCTAGA TATTTGTAGTCCTCTAGAATTTCT 54 62   
HP-NAPE103D F: ACAAATATCTAGAcAAA GAATT c AAAGAGCTCTCTAACACCGCT 54 62 EcoRI 5568
  R: AATTC TTTgTCTAGATATTTGT AGTCCTCTAGAATTTCTTTAAAGA 54 62   
HP-NAPE97GY101H F: ACAAAcAT CTcGAg AAAGAA TTTAAAGAGCTCTCTAACACCG 54 62 XhoI 5261, 307
  R: TTCTTT cTCgAG ATgTTTGT AGTCCcCTAGAATTTCTTTAAAGAT 54 66   
  1. aPrimer-primer overlapping sequences are written in bold
  2. bInserted silent restriction sites are underlined
  3. cMutations are written in lowercase letters
  4. dTmpp and Tmno were calculated as: Tm = 2 °C x (number of the A and T bases) + 4 °C x (number of the G and C bases)
  5. eTmpp was calculated from the primer-primer overlap sequence
  6. fTmno was calculated from the primer sequence matched to the template
  7. gThe Tmno value of 62 °C was used for the PCR reaction to generate the mutations if the Tmno values of forward and reverse primers are different
  8. hThe digested products are DNA fragments from the plasmid with desired mutations after digestion with the inserted silent restriction enzyme