Skip to main content

Table 2 Primer Sequences for EGFR and GAPDH Transcripts used for Real-Time Quantitative reverse Transcriptase Polymerase Chain Reaction

From: Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells

Name Forward exon Sequence Locationa Reverseb exon Sequence LocationΔ Length(bp)
q1 EGFR 370F 2 GGCACTTTTGAAGATCATTTTCTC c.370_393 EGFR 514R 3 CTGTGTTGAGGGCAATGAG c.514_532 163
q2 EGFR 1089F 7 CGAGGGCAAATACAGCTT c.1089_1106 EGFR 1263R 9 AAATTCACCAATACCTATT c.1263_1281 193
q3 EGFR 2034F 15 GGCAGGAGTCATGGGAGAA c.2034_2052 EGFR 2168R 17 GCGATGGACGGGATCTTAG c.2168_2186 153
  GAPDH 240F 3 TTGCCATCAATGACCCCTTCA c.240_260 GAPDH 395R 5 CGCCCCACTTGATTTTGGA c.395_413 173
GAPDH GAPDH 820F 8 TGAACGGGAAGCTCACTGG c.820_837 GAPDH 1106R 9 TCCACCACCCTGTTGCTGTA c.1106_1125 306
  GAPDH 1016F 8 ACCCACTCCTCCACCTTTG c.1016_1034 GAPDH 1175R 9 CTCTTGTGCTCTTGCTGGG c.1175_1193 177
  1. aReference sequence: EGFR NM 005228.3, GAPDH NM 002046.3
  2. bThe reverse primers were also used to initiate cDNA synthesis.