Skip to main content

Table 1 Primer sequences of IGFBP7-AS1, IGFBP7 and the reference gene GAPDH

From: A comprehensive prognostic and immune analysis of enhancer RNA identifies IGFBP7-AS1 as a novel prognostic biomarker in Uterine Corpus Endometrial Carcinoma

Gene symbol Forward primer (5′-3′) Reverse primer (5′-3′)
IGFBP7-AS1 TGGAAAGCTCTTCCTGACCC TGGTGTGACTTCCGCATGTT
IGFBP7 CGAGCAAGGTCCTTCCATAG GGTGTCGGGATTCCGATGAC
GAPDH ATCAATGGAAATCCCATCACCA GACTCCACGACGTACTCAGCG