Skip to main content

Table 1 Primers and sequences used to construct the pCFD4d gRNA plasmid to create the genetically modified flies

From: Efficient In Vivo Introduction of Point Mutations Using ssODN and a Co-CRISPR Approach

Name Sequence (5′ to 3′)
pCFD4d-tin_sgRNA_F TATATAGGAAAGATATCCGGGTGAACTTCGgagctgacaaattgcagacaGTTTTAGAGCTAGAAATAGCAAG
pCFD4d-w_sgRNA_R (tin) ATTTTAACTTGCTATTTCTAGCTCTAAAACccaaagagcaggaatggtatcCGACGTTAAATTGAAAATAGGTC
pCFD4d-w_sgRNA_F (Nup107) TATATAGGAAAGATATCCGGGTGAACTTCGataccattcctgctctttggGTTTTAGAGCTAGAAATAGCAAG
pCFD4d-Nup107_sgRNA_R ATTTTAACTTGCTATTTCTAGCTCTAAAACtcagatgggcccagagcaaacCGACGTTAAATTGAAAATAGGTC
pCFD4d_sequencing_primer GACACAGCGCGTACGTCCTTCG
coffee_seq_primer TATCAACGGAGCCATCTTCCTCTTC