Skip to main content

Table 3 Primers used in the study. Sal I and BamH I restriction sites are underlined.

From: Use of Plasmid pVMG to Make Transcriptional ß-Glucuronidase Reporter Gene Fusions in the Rhizobium Genome for Monitoring the Expression of Rhizobial Genes In Vivo

Name Sequence (5′-3′) usage
Primer 1-sinI ACGCGTCGACGTTGAGTGGTCCGCCTACCG sinI forward
Primer 2-sinI GCTGCGACCGGATCCGTTCACTAT sinI reverse
Primer 3-sinI GGTGGAATGGGCGACAGCGCG sinI forward
Primer 4 GGGTTGGGGTTTCTACAGGA uidA reverse
Primer 1-nop AGCCTTGAACGTCGACTG nop forward
Primer 2-nop ATGGAGGATCCAGCGAG nop reverse
Primer 3-nop AAGTTGGGGTATCGCCCTAAA nop forward
\