Skip to main content

Table 1 RT-PCR Primers

From: Use of RNA Immunoprecipitation Method for Determining Sinorhizobium meliloti RNA-Hfq Protein Associations In Vivo

  Target Primer name Left primer sequence (5′-3′) Primer name Right primer sequence (5′-3′) Reference
1 Smrc7 MG3462 GCACTCATACAATGCCGTGA MG3463 CTCTTTGAAAGCGGGACAAA This work
2 SMrc15 MG2290 GGTGCATCTAGCGGCTTTCT MG2291 GGGCCCTTTCAGTTGTGAAG [11]
3 SMrc16 MG2292 CCACCGCAGCAGCTGTT MG2293 GGCCCTTGTAGTTGTGAAGGTA [11]
4 SMrc45 MG2294 TCGATTAGGTGAGGTTATCG MG2295 CGGTTGGCCGGAATAGC [11]
5 rRNA-16S AB2777 GATAAGCCGAGAGGAAGGTG AB2778 GTGTAGCCCAGCCCGTAAG [40]
6 smelA075 RJ11 GTCGAAGCGCTGTACCT RJ16 GGGAGGAGGTGGCTCGGGG This work
7 Intergenic region between Smc00849-Smc00850 In850F ATTTCTTCAATGACGTTCTCGTCA In849R ATACGTTCAAATTTTATCAT [31]