Skip to main content

Table 1 Oligomers used for aTL assay in human and rodent.

From: A quantitative PCR method for measuring absolute telomere length

  Oligomer Name Species Oligomer sequence (5'-3') Amplicon size
Standards Telomere standard Human/rodent (TTAGGG)14 84 bp
  36B4 standard Human CAGCAAGTGGGAAGGTGTAATCCGTCTCCACAGACAAGGCCAGGACTCGTTTGTACCCGTTGATGATAGAATGGG 75 bp
PCR Primers teloF Human/rodent CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGG TTTGGGTT >76 bp
  teloR Human/rodent GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT  
  36B4F Human CAGCAAGTGGGAAGGTGTAATCC 75 bp
  36B4R Human CCCATTCTATCATCAACGGGTACAA  
  b-globinF Human GCTTCTGACACAACTGTGTTCACTAGC 82 bp
  b-globinR Human CACCAACTTCATCCACGTTCACC  
  36B4F Rodent ACTGGTCTAGGACCCGAGAAG 78 bp
  36B4R Rodent TCAATGGTGCCTCTGGAGATT