Skip to main content

Table 1 Phenotypic consequence of EGFR downregulation by siRNAs

From: Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells

Name of siRNA exon sequence Locationa Designed by RNA knockdown Measured with q2 (%) Protein downregulation (%) Viability (%) Caspase-3/7 (%) Apoptotic cells (%) Viable cells (%)
EGFR siRNA604 3 GCAGTCTTATCTAACTATGATGCAA C.604_628 Invitrogen 19 ± 5 43 ± 3 94 ± 2 170 ± 8 168 ± 6 90 ± 2
EGFR siRNA752 4 GCAGTGACTTTCTCAGCAA C.752_770 Eurogentec 44 ± 13 28 ± 1 96 ± 2 149 ± 6 137 ± 6 94 ± 1
EGFR siRNA1247 8-9 GCAAAGTGTGTAACGGAATAGGTAT C.1247_1271 Invitrogen 72 ± 4 51 ± 3 92 ± 0 179 ± 6 177 ± 7 86 ± 2
EGFR siRNA1608 12 GGAGATAAGTGATGGAGAT C.1608_1626 Eurogentec 25 ± 9 11 ± 1 97 ± 2 132 ± 7 131 ± 6 94 ± 1
EGFR siRNA2654 20 GGGAACACAAAGACAATAT C.2654_2672 Dharmacon 18 ± 22 1 ± 1 106 ± 1 102 ± 6 104 ± 2 92 ± 1
EGFR siRNA2708 20-21 TCGCAAAGGGCATGAACTA C.2708_2726 Dharmacon 21 ± 9 8 ± 1 106 ± 1 141 ± 6 136 ± 6 105 ± 2
EGFR siRNA3768 28 GGACTTCTTTCCCAAGGAA C.3768_3786 Eurogentec 48 ± 8 2 ± 1 97 ± 2 126 ± 6 125 ± 6 96 ± 1
EGFR siRNA4765 28 AGAATGTGGAATACCTAAGG C.4766_4785 * 2 ± 7 2 ± 1 108 ± 3 146 ± 6 137 ± 6 93 ± 3
Negative siRNA   proprietary sequence designed by Eurogentec    16 ± 11 3 ± 1 111 ± 2 97 ± 2 100 ± 2 97 ± 0
Blank control      1 ± 5 1 ± 0 116 ± 2 107 ± 4 101 ± 1 98 ± 1
  1. aReference sequence identical to NM_005228.3 b Modified from [7].